TANRI KODU – DNA’nın Lisanı

Aşağıdaki alıntı Gregg Braden’in ‘Tanrı Kodu: Geçmişimizin Sırrı, Geleceğimizin Vaadi’ adlı kıtabından alınmıştır, (Hay House, Sub. 2004). Tüm kitapçılardan veya www.hayhouse.com dan alınabilir.

Tanrı Kodu: Geçmişimizin Sırrı, Geleceğimizin Vaadi’ Gregg Braden

Bölüm 6 :

Kodun İçindeki Kod : Her Yaşamın Her Hücresinde Tanrı’nın İsmi

DNA’nın Alfabesi : Tercüme edildi

Yaşamın kodunun keşfedildiği andan itibaren, bilim adamları ve bilim adamı – olmayanlar yaşamın genetik mavikopyasını bir “lisan” olarak tanımladılar. 2000 yazı esnasında yapılan bilim konuları ile ilgili bir basın konferansında,başkan Bill Clinton, tarihteki en geniş işbirliği ile yapılan araştırma çabalarının birini tamamlamış olan iki şirketin liderlerinin yanında durdu: İnsan Genom Projesi. Birleşik çabaları vasıtası ile, onlar genetik kodumuzun ilk haritasını ürettiler ve 21 nci yüzyılda tıp ve yaşam bilimlerinin yeni çağına kapı açtılar. Kilometre taşının önemini tanımlarken, Clinton genomun “Tanrı’nın yaşamı yarattığı lisan” olduğunu bildirdi.

Bunlar sadece yaşamın inşa edici bloklarını tanımlamak için – yaşamın kimyasal kodunun “lisanı” – mecazi olarak kullanıldı. Ancak, bu kitapta daha önce tanımlanan ilişkilerden, DNA nın şimdi, kadim ve tercüme edilebilir bir alfabenin çok gerçek lisanı olarak görülebileceği açıktır. O, insanlık ailesi olarak bizi ayırabilecek herhangi farklılıkları aşan tek mesajı saklayan/koruyan lisandır. Bedenlerimizdeki mesajı açığa vurmak için, yaşamın alfabesini anlamamız gerekir.

***

Watson ve Crick’in keşfinin dehası DNA molekülünün kendisini tanımlamalarında yatmaktadır. Çok teknik olmayan terimlerle, yaşamın inşa edici blokları şaşırtıcı şekilde basittir ve hem dikkate değer şekilde hızlı ve verimli, aynı zamanda, göze hoş gelen bir şekilde düzenlenmiştir. Genetik araştırmanın özü tüm yaşamın sadece dört kimyasal bileşenin kombinasyonları olarak oluştuğu anlayışına dayanır. Bu temel yaşam birimleri – adenin, thymin, guanin ve cytosin (sırası ile A, T, G ve C) – DNA nın bazları adlandırılır, var olduğu bilinen yaşamın her formunu üretmek için gerekli bilginin tümünü taşırlar. En küçük tek – hücreli organizmalardan, tek bir insan bedenini oluşturan 100 trilyon hücreye kadar, her yaşam formunun kodu bu dört bazın farklı düzenlenmesinden yapılmıştır.

Sadece kısmen anlaşılan bir proses vasıtası ile, bazlar kendilerini kesin/kusursuz çiftler halinde düzenlerler, bu baz çiftleri olarak bilinir, yaşamın mavikopyalarını üretmek için modelleri içeren her bir çift diğer çiftlerle birleşir. Başka bir deyişle, her baz sadece özel bir partner ile çalışır : guanin daima cytosin ile çift oluşturur (G – C) ve adenin daima thymin ile çift oluşturur (A – T). Çiftler birbirine karşı zıt olarak düzenlenir, kıvrılan merdiven basamakları oluşturarak, merdivene benzer bir yapı oluştururlar, bilinen çifte sarmal. Bu baz çiftleri son birkaç yıldır aşina olan gen – kodu rakamlar ve işaretler sistemini oluşturur. 26 Haziran 2000 de, biri özel diğeri federal iki rakip şirket, insan DNA sını oluşturan bazların nasıl düzenlendiğinin ilk haritasını üretmek için kaynaklarını birleştirdiklerini bildirdiklerinde, dünya huşu içinde izledi. Bu haritayı resimlemede, alfabetik harflerin görünür sonsuz akımları televizyon ekranlarımıza ve popüler dergilerin sayfalarına yansıdı. Bazıları yüzlerce harf uzunluğunda olan diziler insan DNA molekülünde farklı yerlerde teşhis edilen bazları temsil eder. Bu kombinasyonlar genler olarak bilinir. Bir tür olarak bizi eşsiz yapan 23 çift canlı bilgiyi (kromozom) oluşturan genler grubudur. Aşağıda bu kodun görünüşünü resimlemek için insanın kromozomu 1 in bir kısmı var :

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG

İnsan kromozomu 1 in bir parçasından iki yüz kırk baz.

DNA nın kodunu anlamlı bir lisana tercüme etmenin anahtarı elementleri harflere dönüştüren keşfi uygulamaktır. Onların uyuşan değerlerine dayanarak, hidrojen İbrani harfi Yod (Y) olur, azot Hey (H) harfi olur, oksijen Vav (V) harfi olur ve karbon Gimel (G) olur. Bu yerine koymalar şimdi Tanrı’nın isminin kadim şeklinin, YH, genetik kodumuzun tam kimyası olarak mevcut olduğunu ifşa eder. Tanrı’nın ismi ile modern bilimin elementleri arasındaki bu köprü vasıtası ile, şimdi ful gizemi ortaya çıkarmak ve bedenlerimizin her hücresi olarak yaşayan kadim kodda daha büyük anlam bulmak mümkün olur.

Yaşayan Hayatın Her Hücresinde : Ortaya Çıkarılan Kod

Bir görüşme sırasında, Albert Einstein’a Tanrı’nın neye benzediği ile ilgili anlayışını sormuşlardı. Yanıtında, Yaratıcı direkt olarak görülmemesine rağmen, her günümüzün her anında Onun varlığının kanıtının bize gösterildiği gerçeğini ima etti.

Einstein, “Benim Tanrı anlayışım kendisini bilinir dünyada ifşa eden üstün bir zekanın inancının derinden hissedilmesinden gelir” demişti. Böyle samimi içgörüler vasıtası ile, bize dünyamızın altında yatan zekayı kavrayan son yüzyılın en büyük zihinlerinin birinin yoluna bir bakış verildi. Bu zekayı yaşamın elementlerine bağlama keşfi şimdi Einstein’ın algılayışına daha da büyük anlam vermektedir.

Tanrı’nın kadim isminin tüm dört harfini modern elementlerle yer değiştirdiğimizde, önce utanma, belki de beklenmeyen bir sonuç görürüz. YHVH deki son H’yi azotun kimyasal eşdeğeri ile yer değiştirince, Tanrı’nın ismi hidrojen, azot, oksijen ve azot olur (HNON) – hepsi renksiz, kokusuz ve görünmez gazlar ! Başka bir deyişle, Tanrı’nın kişisel isminin yüzde 100 ünü bu dünyanın elementleri ile yer değiştirme elle tutulamaz, ama yaradılışın çok gerçek bir formu olan bir maddeyi yaratır !

Doğrusu, Tanrı’nın daha eski tanımlamalarında, bize Onun omnipresent (her yerde mevcut) olduğu ve dünyamızda gözlerimizle göremeyeceğimiz bir form aldığı anlatılır. Böylece, O sadece Onun tezahürleri vasıtası ile bilinebilir. Sefer Yetzirah Tanrı’nın varlığının bu fiziksel olmayan formunu Tanrı’nın “Nefesi” olarak tanımlar.

“Hiçliğin On Sefirotu : Biri Yaşayan Tanrı’nın Nefesidir, dünyaların Yaşamı…bu Kutsal Nefestir”

İlave olarak, Genesis’in ilk bölümü Yaratıcının yaradılış zamanı esnasında fiziksel olmayan bir formda mevcut olduğunu anlatır. (Genesis 1:2). O, önce dünyanın yüzüne ilerleyen Tanrı’nın ruhu” idi [yazarın vurgusu].

Sefer Yetzirah, evreni mümkün kılan Ana Harf olarak yaradılışın boşluğundan ilk İbrani harfin ortaya çıktığını tanımlar : Alef (Elif). Büyük, mistik bir “sır” vasıtası ile, Alef sonra evrenimizde ortaya çıkmak için ilk elemente tekamül etti/evrimleşti, hidrojen, ayrıca Tanrı’nın isminin ilk harfi olarak : Yod. Big Bang’in modern teorileri şimdi hidrojenin yaradılış anında salıverilen enerjiden oluşan ilk element olduğunu ve evrende tek en bol element olarak kaldığını ileri sürer. Her ikisinin de aynı elementi tanımladığı görülüyor !

Exodus bize YHVH isminin Tanrı’nın kişisel ismi olarak ifşa edildiğini çok spesifik terimlerle hatırlatır. Eşit olarak açık terimlerde, insanlığın Tanrı’nın “imajında” yapıldığı bize gösterildi.Belki bu bildiride tüm var olanın kaynağı ile ilişkimizi tanımlayan en direkt ipucu bulunabilir. Yeni bir vurgu ile, kaynaklarımız ile ilgili bildiri Tanrı olarak veya Tanrı’ya eşit olmak yerine sadece Tanrı’nın imajında yapıldığımızı bize hatırlatır. Süptil olmasına rağmen, bu bildiri, biz Yaratıcımızın niteliklerini inkar edilemez şekilde paylaşırken bizi çok farklı yapan bir şey tarafından YHVH ten ayrı düştüğümüzü de ileri sürer.

Kadim harfler ile modern elementlerin yerini değiştirince, Yaratıcımızın isminin yüzde 75 ini temsil eden ilk üç harfi paylaşmamıza rağmen, kimyasal ismimizin dördüncü ve son harfinin bizi Tanrı’dan ayrı düşürmekte olduğu açıktır. Tanrı’nın varlığı üç gazın, hidrojen, azot ve oksijen, görünmez ve elle tutulmaz formu iken, ismimizin son harfi bize bedenimizin rengini, tadını, sertliğini ve seslerini veren “nesne”dir : karbon. Bizi Tanrı’dan ayrı düşüren tek harf ayrıca bizi dünyamızda “gerçek” yapan elementtir.

Bu, Tanrı’nın basitçe, görünmez elementlerden yapılmış bir gaz serpintisi olduğunu ileri sürmez. Bunun yerine, dünyamızın ve yaşamın temelinin kendisinin mümkün olması, üç milenyum önce Tanrı’nın Musa’ya ifşa ettiği isim vasıtası iledir. Tanrı, evrenin tek en bol elementinin hidrojen formunda olduğunu bize söyler. O, olmuş olan ve olacak olan her şeyin bir parçasıdır.

İnsanın Bedeninde Tanrı’nın İsmi

Efsane, Kral Süleyman Jerusalem’de kutsal tapınağını inşa ettiğinde, ilk taşın yerleştirilmesinden bile önce kadim bir ritüelin gerçekleştiğini belirtir. Bugünkü Masonların gelenekleri vasıtası ile korunan, bu ritüel yönlendirmeyi ve bir taşı yerleştirmeyi içerir, sonunda büyük kompleksin tüm diğer taşlarının yönlendirileceği, köşe taşı (temel taş). Kralın bu temel taşının içine bir parşömen sayfası yerleştirdiği söylenir, bu sayfada o kendisi tek bir ismi yazmış. Sembolik olarak, Jerusalem’in Kutsal Tapınağının temel taşını demirleyen isim ayrıca Kral Süleyman’ın insanlarının liderliğine, ulusunun gücüne dayanan isim oldu ve dünyanın organize dinlerinin üçte biri için temel oldu. O tek isim tetragrammaton YHVH idi, Tanrı’nın zamansız ismi.

Tanrı’nın ve insan bedeninin ismini oluşturan asl harflerin daha yakından incelenmesi bu kadim ilişkinin bize bugün söylediğini tam olarak açıklar. İncil metinlerinin orijinal versiyonları Tanrı’nın ismini YHVH olarak ful olarak bilgilendirir, ayrıca onlar YH olarak kısaltılmış versiyonu ima eder. Bilginler genel olarak bu iki ismin YHVH ve YH nin birbiri ile değişebilir olduğunu kabul ediyor. Tercüme edildiğinde, YH ismi “Sonsuz” olarak okunabilir.

Spesifikler zaman ve kültürler ile değişebilmesine rağmen, modern İngilizcede sonsuz (ebedi) kelimesinin anlamı başlangıcı ve sonu olmayan ve zamanın sınırlamalarının ötesinde fonksiyon gören bir varoluşu ima eder. Hem Tanrı’nın isminde, YHVH, hem de insan bedeninde, YHVG, ortak olan kesinlikle bu “ebedi” veçhedir. Hem eski yapıtların gizli harf kodları, hem de bir alfabe olarak DNA nın kelimesi kelimesine çevirisi vasıtası ile, varlığımız ile ilgili bir şeyin sürekli ve ebedi kaldığı bize gösteriliyor. Genetik kodumuzu tanımlayan elementlerin ful yüzde beşi vasıtası ile Yaratıcımız ile bu asla – sona ermeyen niteliği paylaşıyoruz.

YHVH = Tanrı’nın ismi YHVG = İnsanın ismi

YH (Tanrı/Ebedi) Tanrı’nın isminin bir yarısını ve hücrelerimize kodlanmış ismi oluşturur.

(Çeviri ; Saffet Güler)